Layne14Carlee Layne14Carlee

13-05-2019
Chemistry

contestada

What is the first step in creating a Lewis structure for a molecule?

Respuesta :

Ava45018 Ava45018

13-05-2019

Answer:

Count the number of valence electrons

Explanation:

Answer Link

johnapplestot12 johnapplestot12

13-05-2019

Answer:

I think the correct answer first step in creating a Lewis structure for a molecule is counting the number of valence electrons since these are the electrons which participates in bonding. Hope this answers the question.

Explanation:

Answer Link

Otras preguntas

Which of the following statements regarding privileged users? a) They need to be aware of the extra permissions they've been given. b) More responsibility comes

If you were Rob Rough, What advice would you give to Edith Cooper regarding Auto Star's financial risk?

Based on these data, can the company conclude, at the 0.05 level of significance, that the mean assembly time for Process 1 exceeds that of Process 2?Determine

someone help por favor

Compared to many other regions, emerging adulthood seems to be particularly prolonged in Europe. Why?a) Relaxed parenting practicesb) Long-standing philosophica

In a Station of the Metro - 1916 Erza Pound The apparition of these faces in the crowd; Petals on a wet, black bough. Questions 1. Is the image of the we

Replicate the following gene strand, and then transcribe the template strand:GTTAATGGCCATGATGGCTTTGTGATTAAGC .Translate the mRNA from above using single letter

What is the challenge of measuring the impact of Timberland's social activities on the organization and the community?

What two questions would you ask salinger if you were able to interview him?

You are creating an Azure VM that requires high-performance access to storage. The data kept on the server will be sensitive, so the storage option you select m