15-11-2019
Mathematics

contestada

In triangle PQR point c is the centroid if PQ= 30 then PX=

In triangle PQR point c is the centroid if PQ 30 then PX class=

Respuesta :

kenlingdad kenlingdad

15-11-2019

Answer:

15

Step-by-step explanation:

since c is the centroid, therefore PX=XQ=1/2 x PQ

∴ PX=15

Answer Link

Otras preguntas

Question 8 Unsaved Which medication is considered a NSAID?

According to darwin's theory of evolution, differences between species may be the result of

On a skiing trip there are five people but only three pairs of skis how many different groups of three could ski

Franklin's faucet was leaking, so he put a bucket underneath to catch the water. After a while, Franklin started keeping track of how much water was in the buck

Normal hemoglobin DNA - cacgtggactgaggactcctc What is the normal hemoglodin acid- Normal hemoglobin A.A sequnce For figuring out RNA A binds with U C binds

Help with this please? Points Suppose you graph a system of linear equations and the intersection point appears to be (3,7). Can you be sure that the ordered pa

Moose, red squirrels, ernines, lynx, red-throated loons, and hawk owls are located where

For one History test, John had to answer 45 questions, John answered 33 of them correctly. What percent did John get on his history test? Round your answer to t

The theory of planned behavior includes the basic ideas of the theory of reasoned action but adds another important variable to the model. this variable is

Which statement is true about two angles that are complementary? The angles share a common ray. The sum of the measures of the two angles is 90°. The angles are