salnjpw salnjpw

14-04-2020
Mathematics

contestada

Find the solution of the equation
H-73=29

Respuesta :

14-04-2020

Answer:

22

Step-by-step explanation:

H - 7 = 29

-7 = -7

H = 22

plz mark brainliest

Answer Link

Otras preguntas

Prohibition and the Woman's Christian Temperance Union are examples of Progressive ______. economic reform political reform moral reform efficiency reform

Write the given sentence as an equation. Tim's age in 7 years will be three times what it was 19 years ago. Question options: A)3(t + 19) = t – 7 B) t + 7 = 3(t

1. Quadrilateral ABCD is inscribed in this circle. What is the measure of angle B? 2. Quadrilateral ABCD is inscribed in this circle. What is the me

Find two methods that are equivalent to 3/3

Find the midpoint of side EF. Figure EFGH is shown. E is at negative 2, 3. F is at 1, 6. G is at 4, 3. H is at 1, 0. (−1, 4) (−0.75, 4.25) (−0.5, 4.5) (−0

How might the inconsistent use of daylight saving time have caused problems

Problem Ishaan is 2 times as old as Christopher. 35 years ago, Ishaan was 7 times as old as Christopher. How old is Ishaan now?

1. Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’

Choose the equation below that represents the line passing through the point (2, -4) with a slope of 1/2. y = 1/2 x + 5 y = 1/2x − 3 y = 1/2x − 5 y = 1/2x +

What do both Gulliver’s pocket perspective-glass and his spectacles most likely symbolize in the “A Voyage to Lilliput”section from Gulliver’s Travels? a. impe