sairarascon7511 sairarascon7511

13-03-2018
Biology

contestada

Feelings are often recognized by nonverbal changes, such as blushing.
a. True
b. False

Respuesta :

payshencec21 payshencec21

13-03-2018

Hi there!

There answer should be True.

Hope this helps!!

-Payshence xoxo

Answer Link

Otras preguntas

Finn is eighteen months old. He attends a childcare center each day during the week. When his parents leave him at his classroom each morning, Finn cries for a

A researcher watches children on a playground to obtain measurements of their level of activity. Then the researcher watches the children's caregivers on the pl

A car heading north collides at an intersection with a truck heading east. if they lock together and travel 28 m.s at 46 degrees north of east just after the co

State the observation made when hydrogen chloride gas is passed over ammonia gas

A restriction enzyme is coded for: AT!GC How long would the Base Pair fragments be for this DNA sequence? AGTCGAGTATATGCATGGCCGCGAT 1)25 and 0 2)25 and 25 3)14

What did the British government attempt to do to cover the expenses of the French & Indian War?

Derive the time cost of a block nested loops join of relations R and S given the following variables, which you may or may not use all of them. Ignore the CPU t

Which of the following is a mitochondrion? A. Structure A B. Structure B C. Structure C D. Structure D 6th-grade Cell structure Gizmo

As mentioned that the brain contains at least 100 billion neurons, more than a person needs, the brain going through rapid growth has transient exuberance which

1) How many players are allowed on the court for 1 team? 2) How many minutes do high school basketball games last for in Florida? 3) How long does an offensive